Review



pbr322 with psti  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    New England Biolabs pbr322 with psti
    Stress‐induced BEVs are internalised by recipient cells and mediate horizontal gene transfer (HGT). (a) HGT rate of the tetR ‐cassette using BEVs derived from VC1620/1:: tetR (BEVs VC1620/1:: tetR ) as donor. BEVs VC1620/1:: tetR were isolated from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co). In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). The purified linearised plasmid <t>pBR322</t> (lin PstI) served as an extracellular DNA control. V. cholerae WT grown in AKI or SOC: HEPES served as recipient and was incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) or pBR322 linearised with PstI (100 ng) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (b) HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or diverse V. cholerae mutants as recipient. Recipients, grown in AKI or SOC: HEPES, were incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (c) Internalisation of BEVs VC1620/1:: tetR by V. cholerae WT. Rhodamine‐labelled BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co) were incubated with V. cholerae WT for 20 h. In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). (d) Internalisation of BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) by V. cholerae WT or the deletion mutants ∆ pilA and ∆ comEA . (c, d) Uptake is detected by an increase in relative fluorescence units (RFU) measured every 30 min. Wells containing rhodamine‐labelled BEVs VC1620/1:: tetR without recipient cells served as a blank. Shown is the median ± IQR ( n = 13). The bar chart on the right shows the median area under the curve (AUC) ± IQR calculated from the internalisation assays. Asterisks highlight significant differences between respective data sets (* p < 0.05 Kruskal–Wallis test followed by post hoc Dunn's multiple comparisons). (e) Colonisation fitness of VC1620/1:: tetR and ∆ comEA . Results are shown as competitive index (CI) for competitions of VC1620/1:: tetR or ∆ comEA to a fully virulent LacZ − derivative of the WT ( lacZ − ) in LB (in vitro) and in adult mice (in vivo). Each circle represents the CI from a single assay. Horizontal bars and error bars indicate the median ± IQR. Asterisks highlight data sets with significantly different CI from the theoretical value of 1 [ p < 0.05, Wilcoxon test against a hypothetical value of 1, n = 14 for VC1620/21:: tetR /WT ( lacZ − ) in vitro; n = 12 for ∆ comEA /WT ( lacZ − ) in vitro; n = 8 for VC1620/21:: tetR /WT ( lacZ − ) in vivo; and n = 6 for ∆ comEA /WT ( lacZ − ) in vivo]. (f) In vivo HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or ∆ comEA as recipient. Mice colonised with WT or ∆ comEA received BEVs VC1620/1:: tetR VC1620/1:: tetR by oral gavage twice a day for two days before mice were euthanised and total CFU and transformants were determined by plating the homogenised colon on LB‐Sm and LB‐Tet plates. (a, b, f) Data are presented as median ± IQR. Assays yielding in no transformants on LB‐Tet were set to limit of detection (LOD), which is indicated by a dotted line. The LOD was defined as 0.5 CFU detected in the highest concentration plated on LB‐Tet plates divided by the total CFU determined by plating on LB‐Sm plates. HGT rates significantly higher than the LOD were by evaluated by the Wilcoxon Signed Rank test against the hypothetical value of the LOD (* p < 0.05, n = 8 for Panels a and b, n = 10 for Panel f). Statistically significant differences between the bile‐induced BEVs VC1620/1:: tetR before and after trypsin digest ( n = 8) or between the WT and ∆ comEA colonised mice ( n = 10) were analysed via the Mann–Whitney U test (* p < 0.05). BEV, bacterial extracellular vesicle; IQR, interquartile range; MMC, mitomycin C.
    Pbr322 With Psti, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 3494 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/psti/PstI/pmc13157587-185-14-22
    Average 97 stars, based on 3494 article reviews
    pbr322 with psti - by Bioz Stars, 2026-09
    97/100 stars

    Images

    1) Product Images from "Host Factor Induced Bacterial Extracellular Vesicles Promote Horizontal Gene Transfer in Vibrio cholerae"

    Article Title: Host Factor Induced Bacterial Extracellular Vesicles Promote Horizontal Gene Transfer in Vibrio cholerae

    Journal: Journal of Extracellular Vesicles

    doi: 10.1002/jev2.70301

    Stress‐induced BEVs are internalised by recipient cells and mediate horizontal gene transfer (HGT). (a) HGT rate of the tetR ‐cassette using BEVs derived from VC1620/1:: tetR (BEVs VC1620/1:: tetR ) as donor. BEVs VC1620/1:: tetR were isolated from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co). In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). The purified linearised plasmid pBR322 (lin PstI) served as an extracellular DNA control. V. cholerae WT grown in AKI or SOC: HEPES served as recipient and was incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) or pBR322 linearised with PstI (100 ng) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (b) HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or diverse V. cholerae mutants as recipient. Recipients, grown in AKI or SOC: HEPES, were incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (c) Internalisation of BEVs VC1620/1:: tetR by V. cholerae WT. Rhodamine‐labelled BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co) were incubated with V. cholerae WT for 20 h. In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). (d) Internalisation of BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) by V. cholerae WT or the deletion mutants ∆ pilA and ∆ comEA . (c, d) Uptake is detected by an increase in relative fluorescence units (RFU) measured every 30 min. Wells containing rhodamine‐labelled BEVs VC1620/1:: tetR without recipient cells served as a blank. Shown is the median ± IQR ( n = 13). The bar chart on the right shows the median area under the curve (AUC) ± IQR calculated from the internalisation assays. Asterisks highlight significant differences between respective data sets (* p < 0.05 Kruskal–Wallis test followed by post hoc Dunn's multiple comparisons). (e) Colonisation fitness of VC1620/1:: tetR and ∆ comEA . Results are shown as competitive index (CI) for competitions of VC1620/1:: tetR or ∆ comEA to a fully virulent LacZ − derivative of the WT ( lacZ − ) in LB (in vitro) and in adult mice (in vivo). Each circle represents the CI from a single assay. Horizontal bars and error bars indicate the median ± IQR. Asterisks highlight data sets with significantly different CI from the theoretical value of 1 [ p < 0.05, Wilcoxon test against a hypothetical value of 1, n = 14 for VC1620/21:: tetR /WT ( lacZ − ) in vitro; n = 12 for ∆ comEA /WT ( lacZ − ) in vitro; n = 8 for VC1620/21:: tetR /WT ( lacZ − ) in vivo; and n = 6 for ∆ comEA /WT ( lacZ − ) in vivo]. (f) In vivo HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or ∆ comEA as recipient. Mice colonised with WT or ∆ comEA received BEVs VC1620/1:: tetR VC1620/1:: tetR by oral gavage twice a day for two days before mice were euthanised and total CFU and transformants were determined by plating the homogenised colon on LB‐Sm and LB‐Tet plates. (a, b, f) Data are presented as median ± IQR. Assays yielding in no transformants on LB‐Tet were set to limit of detection (LOD), which is indicated by a dotted line. The LOD was defined as 0.5 CFU detected in the highest concentration plated on LB‐Tet plates divided by the total CFU determined by plating on LB‐Sm plates. HGT rates significantly higher than the LOD were by evaluated by the Wilcoxon Signed Rank test against the hypothetical value of the LOD (* p < 0.05, n = 8 for Panels a and b, n = 10 for Panel f). Statistically significant differences between the bile‐induced BEVs VC1620/1:: tetR before and after trypsin digest ( n = 8) or between the WT and ∆ comEA colonised mice ( n = 10) were analysed via the Mann–Whitney U test (* p < 0.05). BEV, bacterial extracellular vesicle; IQR, interquartile range; MMC, mitomycin C.
    Figure Legend Snippet: Stress‐induced BEVs are internalised by recipient cells and mediate horizontal gene transfer (HGT). (a) HGT rate of the tetR ‐cassette using BEVs derived from VC1620/1:: tetR (BEVs VC1620/1:: tetR ) as donor. BEVs VC1620/1:: tetR were isolated from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co). In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). The purified linearised plasmid pBR322 (lin PstI) served as an extracellular DNA control. V. cholerae WT grown in AKI or SOC: HEPES served as recipient and was incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) or pBR322 linearised with PstI (100 ng) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (b) HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or diverse V. cholerae mutants as recipient. Recipients, grown in AKI or SOC: HEPES, were incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (c) Internalisation of BEVs VC1620/1:: tetR by V. cholerae WT. Rhodamine‐labelled BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co) were incubated with V. cholerae WT for 20 h. In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). (d) Internalisation of BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) by V. cholerae WT or the deletion mutants ∆ pilA and ∆ comEA . (c, d) Uptake is detected by an increase in relative fluorescence units (RFU) measured every 30 min. Wells containing rhodamine‐labelled BEVs VC1620/1:: tetR without recipient cells served as a blank. Shown is the median ± IQR ( n = 13). The bar chart on the right shows the median area under the curve (AUC) ± IQR calculated from the internalisation assays. Asterisks highlight significant differences between respective data sets (* p < 0.05 Kruskal–Wallis test followed by post hoc Dunn's multiple comparisons). (e) Colonisation fitness of VC1620/1:: tetR and ∆ comEA . Results are shown as competitive index (CI) for competitions of VC1620/1:: tetR or ∆ comEA to a fully virulent LacZ − derivative of the WT ( lacZ − ) in LB (in vitro) and in adult mice (in vivo). Each circle represents the CI from a single assay. Horizontal bars and error bars indicate the median ± IQR. Asterisks highlight data sets with significantly different CI from the theoretical value of 1 [ p < 0.05, Wilcoxon test against a hypothetical value of 1, n = 14 for VC1620/21:: tetR /WT ( lacZ − ) in vitro; n = 12 for ∆ comEA /WT ( lacZ − ) in vitro; n = 8 for VC1620/21:: tetR /WT ( lacZ − ) in vivo; and n = 6 for ∆ comEA /WT ( lacZ − ) in vivo]. (f) In vivo HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or ∆ comEA as recipient. Mice colonised with WT or ∆ comEA received BEVs VC1620/1:: tetR VC1620/1:: tetR by oral gavage twice a day for two days before mice were euthanised and total CFU and transformants were determined by plating the homogenised colon on LB‐Sm and LB‐Tet plates. (a, b, f) Data are presented as median ± IQR. Assays yielding in no transformants on LB‐Tet were set to limit of detection (LOD), which is indicated by a dotted line. The LOD was defined as 0.5 CFU detected in the highest concentration plated on LB‐Tet plates divided by the total CFU determined by plating on LB‐Sm plates. HGT rates significantly higher than the LOD were by evaluated by the Wilcoxon Signed Rank test against the hypothetical value of the LOD (* p < 0.05, n = 8 for Panels a and b, n = 10 for Panel f). Statistically significant differences between the bile‐induced BEVs VC1620/1:: tetR before and after trypsin digest ( n = 8) or between the WT and ∆ comEA colonised mice ( n = 10) were analysed via the Mann–Whitney U test (* p < 0.05). BEV, bacterial extracellular vesicle; IQR, interquartile range; MMC, mitomycin C.

    Techniques Used: Derivative Assay, Isolation, Control, Purification, Plasmid Preparation, Incubation, Fluorescence, In Vitro, In Vivo, Concentration Assay, MANN-WHITNEY

    Related Articles

    Polymerase Chain Reaction:

    Article Title: APC coordinates GSK3 phosphorylation of SETD8 to suppress colorectal cancer
    Article Snippet: The following ssODN sequences were used: Setd8-T138A : 5′- GTTATACGAAGCGCTGTGAAGTCAGATGAACAGAAGAGCAAAGACACCAGGAGAGGTCCCCTGGCGCCTTTTCCAAACCAAAAATCCGAAGCTGCAGAACCTCCAAAAGCTCCACCTCCAAGTTGTGATTCTACCAATGTAGCAGTCGCTAAGCAAGCCCTGAAA AAGTCCCTCAAGGGCAAACAGGCCCCTCGGAAAAA-3′ Setd8-T138D : 5′- TTATACGAAGCGCTGTGAAGTCAGATGAACAGAAGAGCAAAGACACCAGGAGAGGTCCCCTGGCGCCTTTTCCAAACCAAAAATCCGAAGCTGCAGAACCTCCAAAAGATCCACCTCCAAGTTGTGATTCTACCAATGTAGCAGTCGCTAAGCAAGCCCTGAAAAAGTCCCTCAAGGGCAAACAGGCCCCTCGGAAAAAG-3′ For genotyping of T138A mESCs and mice, genomic DNA was amplified using Hot-Start Taq Blue (Thomas Scientific C775Y41) using the following primers: Setd8-T138A-F : 5′- GAAAAGGAACACCGGGAACGTTAT-3′ and Setd8-T138A-R : 5′- CCCAGGAACCAAGTGGTGTTAGG-3’. .. Afterward, the PCR product was digested overnight at 37°C with PstI (NEB R0140S) and the resulting digestion products were resolved on an agarose gel. ..

    Article Title: ASO-based PKM splice-switching therapy increases anti-CTLA-4 antibody efficacy in pancreatic ductal adenocarcinoma
    Article Snippet: Radioactive PCR was conducted using 32 P-α-dCTP and 1.25 U of AmpliTaq (N8080171; Invitrogen), with 35 amplification cycles. .. The radiolabeled PCR product was digested with PstI (R0140S, NEB) for 2 h at 37 °C to distinguish PKM1 (undigested) from PKM2 (cleaved into 2 bands). .. Products were separated on a 5% native polyacrylamide gel and then imaged with a Typhoon FAL7000 phosphorimager (GE HealthCare).

    Article Title: Adult-onset Sandhoff disease presenting with a motor neuron disease phenotype: clinical and mechanistic insights from patient-derived models.
    Article Snippet: .. The PCR products were digested with PstI (New England Biolabs, #R0140S) and analyzed by agarose gel electrophoresis. ..

    Article Title: ASO-based PKM splice-switching therapy increases anti-CTLA-4 antibody efficacy in pancreatic ductal adenocarcinoma.
    Article Snippet: Radioactive PCR was conducted using 32P-α-dCTP and 1.25 U of AmpliTaq (N8080171; Invitrogen), with 35 amplification cycles. .. The radiolabeled PCR product was digested with PstI (R0140S, NEB) for 2 h at 37 °C to distinguish PKM1 (undigested) from PKM2 (cleaved into 2 bands). .. Products were separated on a 5% native polyacrylamide gel and then imaged with a Typhoon FAL7000 phosphorimager (GE HealthCare).

    Article Title: Activity-based profiling of bacterial RNA-modifying enzymes reveals species-specific 5-methyluridine modification in Bacillus subtilis 23S rRNA
    Article Snippet: For construction of B. subtilis add-back (Δ yfjO+yfjO + ) strain, yfjO was cloned into integrative plasmid pBS1C ( ) (Addgene, plasmid #55168) with two recombination sites for insertion at the amyE locus. .. The yfjO coding sequence along with 250 bp flanking region (5’ and 3’) was PCR amplified from B. subtilis WT 168 genomic DNA, digested with EcoRI (NEB) and PstI (NEB), and ligated into the pBS1C backbone with T4 DNA ligase (NEB). ..

    Agarose Gel Electrophoresis:

    Article Title: APC coordinates GSK3 phosphorylation of SETD8 to suppress colorectal cancer
    Article Snippet: The following ssODN sequences were used: Setd8-T138A : 5′- GTTATACGAAGCGCTGTGAAGTCAGATGAACAGAAGAGCAAAGACACCAGGAGAGGTCCCCTGGCGCCTTTTCCAAACCAAAAATCCGAAGCTGCAGAACCTCCAAAAGCTCCACCTCCAAGTTGTGATTCTACCAATGTAGCAGTCGCTAAGCAAGCCCTGAAA AAGTCCCTCAAGGGCAAACAGGCCCCTCGGAAAAA-3′ Setd8-T138D : 5′- TTATACGAAGCGCTGTGAAGTCAGATGAACAGAAGAGCAAAGACACCAGGAGAGGTCCCCTGGCGCCTTTTCCAAACCAAAAATCCGAAGCTGCAGAACCTCCAAAAGATCCACCTCCAAGTTGTGATTCTACCAATGTAGCAGTCGCTAAGCAAGCCCTGAAAAAGTCCCTCAAGGGCAAACAGGCCCCTCGGAAAAAG-3′ For genotyping of T138A mESCs and mice, genomic DNA was amplified using Hot-Start Taq Blue (Thomas Scientific C775Y41) using the following primers: Setd8-T138A-F : 5′- GAAAAGGAACACCGGGAACGTTAT-3′ and Setd8-T138A-R : 5′- CCCAGGAACCAAGTGGTGTTAGG-3’. .. Afterward, the PCR product was digested overnight at 37°C with PstI (NEB R0140S) and the resulting digestion products were resolved on an agarose gel. ..

    Article Title: Adult-onset Sandhoff disease presenting with a motor neuron disease phenotype: clinical and mechanistic insights from patient-derived models.
    Article Snippet: .. The PCR products were digested with PstI (New England Biolabs, #R0140S) and analyzed by agarose gel electrophoresis. ..

    other:

    Article Title: Gene regulatory co-option drives birdsong neural circuit specialization
    Article Snippet: Imaging was performed on a Zeiss 880 Confocal at the UCSC Microscopy Core facility using a 10X objective.

    Plasmid Preparation:

    Article Title: Nonsense-mediated mRNA decay factors target short poly(A)-tailed mRNAs lacking a premature termination codon.
    Article Snippet: .. pCM189-HIS3opt plasmid (pCM189-NFLAG-HIS3-100 - TETO7-NFLAG-HIS3-100 #GIM1640), originally described by27 was modified by replacing the original HIS3-opt coding sequence by a Bam HI (NEB Cat# R0136S]) and PstI (NEB Cat# R0140S) digested fragment with all internal out-of-frame stop codons removed (No-Stop) or with a unique stop codon in frame +1 and +2 (Stop +1+2). .. The modified HIS3 sequences were cloned into pCM189 by ligation with T4 DNA ligase (NEB Cat#M0202T), amplified in Escherichia coli and sequenced (Eurofins genomic) generating plasmid pCM189-HIS3nostop (#GIM1803) and pCM189HIS3stop12(#GIM1804).

    Modification:

    Article Title: Nonsense-mediated mRNA decay factors target short poly(A)-tailed mRNAs lacking a premature termination codon.
    Article Snippet: .. pCM189-HIS3opt plasmid (pCM189-NFLAG-HIS3-100 - TETO7-NFLAG-HIS3-100 #GIM1640), originally described by27 was modified by replacing the original HIS3-opt coding sequence by a Bam HI (NEB Cat# R0136S]) and PstI (NEB Cat# R0140S) digested fragment with all internal out-of-frame stop codons removed (No-Stop) or with a unique stop codon in frame +1 and +2 (Stop +1+2). .. The modified HIS3 sequences were cloned into pCM189 by ligation with T4 DNA ligase (NEB Cat#M0202T), amplified in Escherichia coli and sequenced (Eurofins genomic) generating plasmid pCM189-HIS3nostop (#GIM1803) and pCM189HIS3stop12(#GIM1804).

    Sequencing:

    Article Title: Nonsense-mediated mRNA decay factors target short poly(A)-tailed mRNAs lacking a premature termination codon.
    Article Snippet: .. pCM189-HIS3opt plasmid (pCM189-NFLAG-HIS3-100 - TETO7-NFLAG-HIS3-100 #GIM1640), originally described by27 was modified by replacing the original HIS3-opt coding sequence by a Bam HI (NEB Cat# R0136S]) and PstI (NEB Cat# R0140S) digested fragment with all internal out-of-frame stop codons removed (No-Stop) or with a unique stop codon in frame +1 and +2 (Stop +1+2). .. The modified HIS3 sequences were cloned into pCM189 by ligation with T4 DNA ligase (NEB Cat#M0202T), amplified in Escherichia coli and sequenced (Eurofins genomic) generating plasmid pCM189-HIS3nostop (#GIM1803) and pCM189HIS3stop12(#GIM1804).

    Article Title: Activity-based profiling of bacterial RNA-modifying enzymes reveals species-specific 5-methyluridine modification in Bacillus subtilis 23S rRNA
    Article Snippet: For construction of B. subtilis add-back (Δ yfjO+yfjO + ) strain, yfjO was cloned into integrative plasmid pBS1C ( ) (Addgene, plasmid #55168) with two recombination sites for insertion at the amyE locus. .. The yfjO coding sequence along with 250 bp flanking region (5’ and 3’) was PCR amplified from B. subtilis WT 168 genomic DNA, digested with EcoRI (NEB) and PstI (NEB), and ligated into the pBS1C backbone with T4 DNA ligase (NEB). ..

    Amplification:

    Article Title: Activity-based profiling of bacterial RNA-modifying enzymes reveals species-specific 5-methyluridine modification in Bacillus subtilis 23S rRNA
    Article Snippet: For construction of B. subtilis add-back (Δ yfjO+yfjO + ) strain, yfjO was cloned into integrative plasmid pBS1C ( ) (Addgene, plasmid #55168) with two recombination sites for insertion at the amyE locus. .. The yfjO coding sequence along with 250 bp flanking region (5’ and 3’) was PCR amplified from B. subtilis WT 168 genomic DNA, digested with EcoRI (NEB) and PstI (NEB), and ligated into the pBS1C backbone with T4 DNA ligase (NEB). ..



    Similar Products

    97
    New England Biolabs pbr322 with psti
    Stress‐induced BEVs are internalised by recipient cells and mediate horizontal gene transfer (HGT). (a) HGT rate of the tetR ‐cassette using BEVs derived from VC1620/1:: tetR (BEVs VC1620/1:: tetR ) as donor. BEVs VC1620/1:: tetR were isolated from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co). In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). The purified linearised plasmid <t>pBR322</t> (lin PstI) served as an extracellular DNA control. V. cholerae WT grown in AKI or SOC: HEPES served as recipient and was incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) or pBR322 linearised with PstI (100 ng) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (b) HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or diverse V. cholerae mutants as recipient. Recipients, grown in AKI or SOC: HEPES, were incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (c) Internalisation of BEVs VC1620/1:: tetR by V. cholerae WT. Rhodamine‐labelled BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co) were incubated with V. cholerae WT for 20 h. In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). (d) Internalisation of BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) by V. cholerae WT or the deletion mutants ∆ pilA and ∆ comEA . (c, d) Uptake is detected by an increase in relative fluorescence units (RFU) measured every 30 min. Wells containing rhodamine‐labelled BEVs VC1620/1:: tetR without recipient cells served as a blank. Shown is the median ± IQR ( n = 13). The bar chart on the right shows the median area under the curve (AUC) ± IQR calculated from the internalisation assays. Asterisks highlight significant differences between respective data sets (* p < 0.05 Kruskal–Wallis test followed by post hoc Dunn's multiple comparisons). (e) Colonisation fitness of VC1620/1:: tetR and ∆ comEA . Results are shown as competitive index (CI) for competitions of VC1620/1:: tetR or ∆ comEA to a fully virulent LacZ − derivative of the WT ( lacZ − ) in LB (in vitro) and in adult mice (in vivo). Each circle represents the CI from a single assay. Horizontal bars and error bars indicate the median ± IQR. Asterisks highlight data sets with significantly different CI from the theoretical value of 1 [ p < 0.05, Wilcoxon test against a hypothetical value of 1, n = 14 for VC1620/21:: tetR /WT ( lacZ − ) in vitro; n = 12 for ∆ comEA /WT ( lacZ − ) in vitro; n = 8 for VC1620/21:: tetR /WT ( lacZ − ) in vivo; and n = 6 for ∆ comEA /WT ( lacZ − ) in vivo]. (f) In vivo HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or ∆ comEA as recipient. Mice colonised with WT or ∆ comEA received BEVs VC1620/1:: tetR VC1620/1:: tetR by oral gavage twice a day for two days before mice were euthanised and total CFU and transformants were determined by plating the homogenised colon on LB‐Sm and LB‐Tet plates. (a, b, f) Data are presented as median ± IQR. Assays yielding in no transformants on LB‐Tet were set to limit of detection (LOD), which is indicated by a dotted line. The LOD was defined as 0.5 CFU detected in the highest concentration plated on LB‐Tet plates divided by the total CFU determined by plating on LB‐Sm plates. HGT rates significantly higher than the LOD were by evaluated by the Wilcoxon Signed Rank test against the hypothetical value of the LOD (* p < 0.05, n = 8 for Panels a and b, n = 10 for Panel f). Statistically significant differences between the bile‐induced BEVs VC1620/1:: tetR before and after trypsin digest ( n = 8) or between the WT and ∆ comEA colonised mice ( n = 10) were analysed via the Mann–Whitney U test (* p < 0.05). BEV, bacterial extracellular vesicle; IQR, interquartile range; MMC, mitomycin C.
    Pbr322 With Psti, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/psti/PstI/pmc13157587-185-14-22
    Average 97 stars, based on 1 article reviews
    pbr322 with psti - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    New England Biolabs restriction endonuclease psti
    Stress‐induced BEVs are internalised by recipient cells and mediate horizontal gene transfer (HGT). (a) HGT rate of the tetR ‐cassette using BEVs derived from VC1620/1:: tetR (BEVs VC1620/1:: tetR ) as donor. BEVs VC1620/1:: tetR were isolated from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co). In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). The purified linearised plasmid <t>pBR322</t> (lin PstI) served as an extracellular DNA control. V. cholerae WT grown in AKI or SOC: HEPES served as recipient and was incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) or pBR322 linearised with PstI (100 ng) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (b) HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or diverse V. cholerae mutants as recipient. Recipients, grown in AKI or SOC: HEPES, were incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (c) Internalisation of BEVs VC1620/1:: tetR by V. cholerae WT. Rhodamine‐labelled BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co) were incubated with V. cholerae WT for 20 h. In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). (d) Internalisation of BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) by V. cholerae WT or the deletion mutants ∆ pilA and ∆ comEA . (c, d) Uptake is detected by an increase in relative fluorescence units (RFU) measured every 30 min. Wells containing rhodamine‐labelled BEVs VC1620/1:: tetR without recipient cells served as a blank. Shown is the median ± IQR ( n = 13). The bar chart on the right shows the median area under the curve (AUC) ± IQR calculated from the internalisation assays. Asterisks highlight significant differences between respective data sets (* p < 0.05 Kruskal–Wallis test followed by post hoc Dunn's multiple comparisons). (e) Colonisation fitness of VC1620/1:: tetR and ∆ comEA . Results are shown as competitive index (CI) for competitions of VC1620/1:: tetR or ∆ comEA to a fully virulent LacZ − derivative of the WT ( lacZ − ) in LB (in vitro) and in adult mice (in vivo). Each circle represents the CI from a single assay. Horizontal bars and error bars indicate the median ± IQR. Asterisks highlight data sets with significantly different CI from the theoretical value of 1 [ p < 0.05, Wilcoxon test against a hypothetical value of 1, n = 14 for VC1620/21:: tetR /WT ( lacZ − ) in vitro; n = 12 for ∆ comEA /WT ( lacZ − ) in vitro; n = 8 for VC1620/21:: tetR /WT ( lacZ − ) in vivo; and n = 6 for ∆ comEA /WT ( lacZ − ) in vivo]. (f) In vivo HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or ∆ comEA as recipient. Mice colonised with WT or ∆ comEA received BEVs VC1620/1:: tetR VC1620/1:: tetR by oral gavage twice a day for two days before mice were euthanised and total CFU and transformants were determined by plating the homogenised colon on LB‐Sm and LB‐Tet plates. (a, b, f) Data are presented as median ± IQR. Assays yielding in no transformants on LB‐Tet were set to limit of detection (LOD), which is indicated by a dotted line. The LOD was defined as 0.5 CFU detected in the highest concentration plated on LB‐Tet plates divided by the total CFU determined by plating on LB‐Sm plates. HGT rates significantly higher than the LOD were by evaluated by the Wilcoxon Signed Rank test against the hypothetical value of the LOD (* p < 0.05, n = 8 for Panels a and b, n = 10 for Panel f). Statistically significant differences between the bile‐induced BEVs VC1620/1:: tetR before and after trypsin digest ( n = 8) or between the WT and ∆ comEA colonised mice ( n = 10) were analysed via the Mann–Whitney U test (* p < 0.05). BEV, bacterial extracellular vesicle; IQR, interquartile range; MMC, mitomycin C.
    Restriction Endonuclease Psti, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/psti/PstI/pm42092188-190-7-11
    Average 97 stars, based on 1 article reviews
    restriction endonuclease psti - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    New England Biolabs psti
    Stress‐induced BEVs are internalised by recipient cells and mediate horizontal gene transfer (HGT). (a) HGT rate of the tetR ‐cassette using BEVs derived from VC1620/1:: tetR (BEVs VC1620/1:: tetR ) as donor. BEVs VC1620/1:: tetR were isolated from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co). In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). The purified linearised plasmid <t>pBR322</t> (lin PstI) served as an extracellular DNA control. V. cholerae WT grown in AKI or SOC: HEPES served as recipient and was incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) or pBR322 linearised with PstI (100 ng) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (b) HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or diverse V. cholerae mutants as recipient. Recipients, grown in AKI or SOC: HEPES, were incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (c) Internalisation of BEVs VC1620/1:: tetR by V. cholerae WT. Rhodamine‐labelled BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co) were incubated with V. cholerae WT for 20 h. In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). (d) Internalisation of BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) by V. cholerae WT or the deletion mutants ∆ pilA and ∆ comEA . (c, d) Uptake is detected by an increase in relative fluorescence units (RFU) measured every 30 min. Wells containing rhodamine‐labelled BEVs VC1620/1:: tetR without recipient cells served as a blank. Shown is the median ± IQR ( n = 13). The bar chart on the right shows the median area under the curve (AUC) ± IQR calculated from the internalisation assays. Asterisks highlight significant differences between respective data sets (* p < 0.05 Kruskal–Wallis test followed by post hoc Dunn's multiple comparisons). (e) Colonisation fitness of VC1620/1:: tetR and ∆ comEA . Results are shown as competitive index (CI) for competitions of VC1620/1:: tetR or ∆ comEA to a fully virulent LacZ − derivative of the WT ( lacZ − ) in LB (in vitro) and in adult mice (in vivo). Each circle represents the CI from a single assay. Horizontal bars and error bars indicate the median ± IQR. Asterisks highlight data sets with significantly different CI from the theoretical value of 1 [ p < 0.05, Wilcoxon test against a hypothetical value of 1, n = 14 for VC1620/21:: tetR /WT ( lacZ − ) in vitro; n = 12 for ∆ comEA /WT ( lacZ − ) in vitro; n = 8 for VC1620/21:: tetR /WT ( lacZ − ) in vivo; and n = 6 for ∆ comEA /WT ( lacZ − ) in vivo]. (f) In vivo HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or ∆ comEA as recipient. Mice colonised with WT or ∆ comEA received BEVs VC1620/1:: tetR VC1620/1:: tetR by oral gavage twice a day for two days before mice were euthanised and total CFU and transformants were determined by plating the homogenised colon on LB‐Sm and LB‐Tet plates. (a, b, f) Data are presented as median ± IQR. Assays yielding in no transformants on LB‐Tet were set to limit of detection (LOD), which is indicated by a dotted line. The LOD was defined as 0.5 CFU detected in the highest concentration plated on LB‐Tet plates divided by the total CFU determined by plating on LB‐Sm plates. HGT rates significantly higher than the LOD were by evaluated by the Wilcoxon Signed Rank test against the hypothetical value of the LOD (* p < 0.05, n = 8 for Panels a and b, n = 10 for Panel f). Statistically significant differences between the bile‐induced BEVs VC1620/1:: tetR before and after trypsin digest ( n = 8) or between the WT and ∆ comEA colonised mice ( n = 10) were analysed via the Mann–Whitney U test (* p < 0.05). BEV, bacterial extracellular vesicle; IQR, interquartile range; MMC, mitomycin C.
    Psti, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/psti/PstI/pm42087242-110-6-7
    Average 97 stars, based on 1 article reviews
    psti - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    86
    Floragenex psti
    Stress‐induced BEVs are internalised by recipient cells and mediate horizontal gene transfer (HGT). (a) HGT rate of the tetR ‐cassette using BEVs derived from VC1620/1:: tetR (BEVs VC1620/1:: tetR ) as donor. BEVs VC1620/1:: tetR were isolated from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co). In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). The purified linearised plasmid <t>pBR322</t> (lin PstI) served as an extracellular DNA control. V. cholerae WT grown in AKI or SOC: HEPES served as recipient and was incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) or pBR322 linearised with PstI (100 ng) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (b) HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or diverse V. cholerae mutants as recipient. Recipients, grown in AKI or SOC: HEPES, were incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (c) Internalisation of BEVs VC1620/1:: tetR by V. cholerae WT. Rhodamine‐labelled BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co) were incubated with V. cholerae WT for 20 h. In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). (d) Internalisation of BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) by V. cholerae WT or the deletion mutants ∆ pilA and ∆ comEA . (c, d) Uptake is detected by an increase in relative fluorescence units (RFU) measured every 30 min. Wells containing rhodamine‐labelled BEVs VC1620/1:: tetR without recipient cells served as a blank. Shown is the median ± IQR ( n = 13). The bar chart on the right shows the median area under the curve (AUC) ± IQR calculated from the internalisation assays. Asterisks highlight significant differences between respective data sets (* p < 0.05 Kruskal–Wallis test followed by post hoc Dunn's multiple comparisons). (e) Colonisation fitness of VC1620/1:: tetR and ∆ comEA . Results are shown as competitive index (CI) for competitions of VC1620/1:: tetR or ∆ comEA to a fully virulent LacZ − derivative of the WT ( lacZ − ) in LB (in vitro) and in adult mice (in vivo). Each circle represents the CI from a single assay. Horizontal bars and error bars indicate the median ± IQR. Asterisks highlight data sets with significantly different CI from the theoretical value of 1 [ p < 0.05, Wilcoxon test against a hypothetical value of 1, n = 14 for VC1620/21:: tetR /WT ( lacZ − ) in vitro; n = 12 for ∆ comEA /WT ( lacZ − ) in vitro; n = 8 for VC1620/21:: tetR /WT ( lacZ − ) in vivo; and n = 6 for ∆ comEA /WT ( lacZ − ) in vivo]. (f) In vivo HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or ∆ comEA as recipient. Mice colonised with WT or ∆ comEA received BEVs VC1620/1:: tetR VC1620/1:: tetR by oral gavage twice a day for two days before mice were euthanised and total CFU and transformants were determined by plating the homogenised colon on LB‐Sm and LB‐Tet plates. (a, b, f) Data are presented as median ± IQR. Assays yielding in no transformants on LB‐Tet were set to limit of detection (LOD), which is indicated by a dotted line. The LOD was defined as 0.5 CFU detected in the highest concentration plated on LB‐Tet plates divided by the total CFU determined by plating on LB‐Sm plates. HGT rates significantly higher than the LOD were by evaluated by the Wilcoxon Signed Rank test against the hypothetical value of the LOD (* p < 0.05, n = 8 for Panels a and b, n = 10 for Panel f). Statistically significant differences between the bile‐induced BEVs VC1620/1:: tetR before and after trypsin digest ( n = 8) or between the WT and ∆ comEA colonised mice ( n = 10) were analysed via the Mann–Whitney U test (* p < 0.05). BEV, bacterial extracellular vesicle; IQR, interquartile range; MMC, mitomycin C.
    Psti, supplied by Floragenex, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/psti/psti/pm42081728-193-9-5
    Average 86 stars, based on 1 article reviews
    psti - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    97
    New England Biolabs psti restriction enzyme
    Stress‐induced BEVs are internalised by recipient cells and mediate horizontal gene transfer (HGT). (a) HGT rate of the tetR ‐cassette using BEVs derived from VC1620/1:: tetR (BEVs VC1620/1:: tetR ) as donor. BEVs VC1620/1:: tetR were isolated from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co). In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). The purified linearised plasmid <t>pBR322</t> (lin PstI) served as an extracellular DNA control. V. cholerae WT grown in AKI or SOC: HEPES served as recipient and was incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) or pBR322 linearised with PstI (100 ng) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (b) HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or diverse V. cholerae mutants as recipient. Recipients, grown in AKI or SOC: HEPES, were incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (c) Internalisation of BEVs VC1620/1:: tetR by V. cholerae WT. Rhodamine‐labelled BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co) were incubated with V. cholerae WT for 20 h. In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). (d) Internalisation of BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) by V. cholerae WT or the deletion mutants ∆ pilA and ∆ comEA . (c, d) Uptake is detected by an increase in relative fluorescence units (RFU) measured every 30 min. Wells containing rhodamine‐labelled BEVs VC1620/1:: tetR without recipient cells served as a blank. Shown is the median ± IQR ( n = 13). The bar chart on the right shows the median area under the curve (AUC) ± IQR calculated from the internalisation assays. Asterisks highlight significant differences between respective data sets (* p < 0.05 Kruskal–Wallis test followed by post hoc Dunn's multiple comparisons). (e) Colonisation fitness of VC1620/1:: tetR and ∆ comEA . Results are shown as competitive index (CI) for competitions of VC1620/1:: tetR or ∆ comEA to a fully virulent LacZ − derivative of the WT ( lacZ − ) in LB (in vitro) and in adult mice (in vivo). Each circle represents the CI from a single assay. Horizontal bars and error bars indicate the median ± IQR. Asterisks highlight data sets with significantly different CI from the theoretical value of 1 [ p < 0.05, Wilcoxon test against a hypothetical value of 1, n = 14 for VC1620/21:: tetR /WT ( lacZ − ) in vitro; n = 12 for ∆ comEA /WT ( lacZ − ) in vitro; n = 8 for VC1620/21:: tetR /WT ( lacZ − ) in vivo; and n = 6 for ∆ comEA /WT ( lacZ − ) in vivo]. (f) In vivo HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or ∆ comEA as recipient. Mice colonised with WT or ∆ comEA received BEVs VC1620/1:: tetR VC1620/1:: tetR by oral gavage twice a day for two days before mice were euthanised and total CFU and transformants were determined by plating the homogenised colon on LB‐Sm and LB‐Tet plates. (a, b, f) Data are presented as median ± IQR. Assays yielding in no transformants on LB‐Tet were set to limit of detection (LOD), which is indicated by a dotted line. The LOD was defined as 0.5 CFU detected in the highest concentration plated on LB‐Tet plates divided by the total CFU determined by plating on LB‐Sm plates. HGT rates significantly higher than the LOD were by evaluated by the Wilcoxon Signed Rank test against the hypothetical value of the LOD (* p < 0.05, n = 8 for Panels a and b, n = 10 for Panel f). Statistically significant differences between the bile‐induced BEVs VC1620/1:: tetR before and after trypsin digest ( n = 8) or between the WT and ∆ comEA colonised mice ( n = 10) were analysed via the Mann–Whitney U test (* p < 0.05). BEV, bacterial extracellular vesicle; IQR, interquartile range; MMC, mitomycin C.
    Psti Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/psti/PstI/pmc13126619-66-21-24
    Average 97 stars, based on 1 article reviews
    psti restriction enzyme - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    New England Biolabs psti high fidelity restriction enzyme
    Stress‐induced BEVs are internalised by recipient cells and mediate horizontal gene transfer (HGT). (a) HGT rate of the tetR ‐cassette using BEVs derived from VC1620/1:: tetR (BEVs VC1620/1:: tetR ) as donor. BEVs VC1620/1:: tetR were isolated from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co). In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). The purified linearised plasmid <t>pBR322</t> (lin PstI) served as an extracellular DNA control. V. cholerae WT grown in AKI or SOC: HEPES served as recipient and was incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) or pBR322 linearised with PstI (100 ng) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (b) HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or diverse V. cholerae mutants as recipient. Recipients, grown in AKI or SOC: HEPES, were incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (c) Internalisation of BEVs VC1620/1:: tetR by V. cholerae WT. Rhodamine‐labelled BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co) were incubated with V. cholerae WT for 20 h. In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). (d) Internalisation of BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) by V. cholerae WT or the deletion mutants ∆ pilA and ∆ comEA . (c, d) Uptake is detected by an increase in relative fluorescence units (RFU) measured every 30 min. Wells containing rhodamine‐labelled BEVs VC1620/1:: tetR without recipient cells served as a blank. Shown is the median ± IQR ( n = 13). The bar chart on the right shows the median area under the curve (AUC) ± IQR calculated from the internalisation assays. Asterisks highlight significant differences between respective data sets (* p < 0.05 Kruskal–Wallis test followed by post hoc Dunn's multiple comparisons). (e) Colonisation fitness of VC1620/1:: tetR and ∆ comEA . Results are shown as competitive index (CI) for competitions of VC1620/1:: tetR or ∆ comEA to a fully virulent LacZ − derivative of the WT ( lacZ − ) in LB (in vitro) and in adult mice (in vivo). Each circle represents the CI from a single assay. Horizontal bars and error bars indicate the median ± IQR. Asterisks highlight data sets with significantly different CI from the theoretical value of 1 [ p < 0.05, Wilcoxon test against a hypothetical value of 1, n = 14 for VC1620/21:: tetR /WT ( lacZ − ) in vitro; n = 12 for ∆ comEA /WT ( lacZ − ) in vitro; n = 8 for VC1620/21:: tetR /WT ( lacZ − ) in vivo; and n = 6 for ∆ comEA /WT ( lacZ − ) in vivo]. (f) In vivo HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or ∆ comEA as recipient. Mice colonised with WT or ∆ comEA received BEVs VC1620/1:: tetR VC1620/1:: tetR by oral gavage twice a day for two days before mice were euthanised and total CFU and transformants were determined by plating the homogenised colon on LB‐Sm and LB‐Tet plates. (a, b, f) Data are presented as median ± IQR. Assays yielding in no transformants on LB‐Tet were set to limit of detection (LOD), which is indicated by a dotted line. The LOD was defined as 0.5 CFU detected in the highest concentration plated on LB‐Tet plates divided by the total CFU determined by plating on LB‐Sm plates. HGT rates significantly higher than the LOD were by evaluated by the Wilcoxon Signed Rank test against the hypothetical value of the LOD (* p < 0.05, n = 8 for Panels a and b, n = 10 for Panel f). Statistically significant differences between the bile‐induced BEVs VC1620/1:: tetR before and after trypsin digest ( n = 8) or between the WT and ∆ comEA colonised mice ( n = 10) were analysed via the Mann–Whitney U test (* p < 0.05). BEV, bacterial extracellular vesicle; IQR, interquartile range; MMC, mitomycin C.
    Psti High Fidelity Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/psti/PstI/pmc13122877-143-14-19
    Average 97 stars, based on 1 article reviews
    psti high fidelity restriction enzyme - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    New England Biolabs psti site
    Stress‐induced BEVs are internalised by recipient cells and mediate horizontal gene transfer (HGT). (a) HGT rate of the tetR ‐cassette using BEVs derived from VC1620/1:: tetR (BEVs VC1620/1:: tetR ) as donor. BEVs VC1620/1:: tetR were isolated from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co). In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). The purified linearised plasmid <t>pBR322</t> (lin PstI) served as an extracellular DNA control. V. cholerae WT grown in AKI or SOC: HEPES served as recipient and was incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) or pBR322 linearised with PstI (100 ng) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (b) HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or diverse V. cholerae mutants as recipient. Recipients, grown in AKI or SOC: HEPES, were incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (c) Internalisation of BEVs VC1620/1:: tetR by V. cholerae WT. Rhodamine‐labelled BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co) were incubated with V. cholerae WT for 20 h. In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). (d) Internalisation of BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) by V. cholerae WT or the deletion mutants ∆ pilA and ∆ comEA . (c, d) Uptake is detected by an increase in relative fluorescence units (RFU) measured every 30 min. Wells containing rhodamine‐labelled BEVs VC1620/1:: tetR without recipient cells served as a blank. Shown is the median ± IQR ( n = 13). The bar chart on the right shows the median area under the curve (AUC) ± IQR calculated from the internalisation assays. Asterisks highlight significant differences between respective data sets (* p < 0.05 Kruskal–Wallis test followed by post hoc Dunn's multiple comparisons). (e) Colonisation fitness of VC1620/1:: tetR and ∆ comEA . Results are shown as competitive index (CI) for competitions of VC1620/1:: tetR or ∆ comEA to a fully virulent LacZ − derivative of the WT ( lacZ − ) in LB (in vitro) and in adult mice (in vivo). Each circle represents the CI from a single assay. Horizontal bars and error bars indicate the median ± IQR. Asterisks highlight data sets with significantly different CI from the theoretical value of 1 [ p < 0.05, Wilcoxon test against a hypothetical value of 1, n = 14 for VC1620/21:: tetR /WT ( lacZ − ) in vitro; n = 12 for ∆ comEA /WT ( lacZ − ) in vitro; n = 8 for VC1620/21:: tetR /WT ( lacZ − ) in vivo; and n = 6 for ∆ comEA /WT ( lacZ − ) in vivo]. (f) In vivo HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or ∆ comEA as recipient. Mice colonised with WT or ∆ comEA received BEVs VC1620/1:: tetR VC1620/1:: tetR by oral gavage twice a day for two days before mice were euthanised and total CFU and transformants were determined by plating the homogenised colon on LB‐Sm and LB‐Tet plates. (a, b, f) Data are presented as median ± IQR. Assays yielding in no transformants on LB‐Tet were set to limit of detection (LOD), which is indicated by a dotted line. The LOD was defined as 0.5 CFU detected in the highest concentration plated on LB‐Tet plates divided by the total CFU determined by plating on LB‐Sm plates. HGT rates significantly higher than the LOD were by evaluated by the Wilcoxon Signed Rank test against the hypothetical value of the LOD (* p < 0.05, n = 8 for Panels a and b, n = 10 for Panel f). Statistically significant differences between the bile‐induced BEVs VC1620/1:: tetR before and after trypsin digest ( n = 8) or between the WT and ∆ comEA colonised mice ( n = 10) were analysed via the Mann–Whitney U test (* p < 0.05). BEV, bacterial extracellular vesicle; IQR, interquartile range; MMC, mitomycin C.
    Psti Site, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/psti/PstI/pm42043483-39-6-22
    Average 97 stars, based on 1 article reviews
    psti site - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    New England Biolabs base cutter psti
    Stress‐induced BEVs are internalised by recipient cells and mediate horizontal gene transfer (HGT). (a) HGT rate of the tetR ‐cassette using BEVs derived from VC1620/1:: tetR (BEVs VC1620/1:: tetR ) as donor. BEVs VC1620/1:: tetR were isolated from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co). In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). The purified linearised plasmid <t>pBR322</t> (lin PstI) served as an extracellular DNA control. V. cholerae WT grown in AKI or SOC: HEPES served as recipient and was incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) or pBR322 linearised with PstI (100 ng) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (b) HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or diverse V. cholerae mutants as recipient. Recipients, grown in AKI or SOC: HEPES, were incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (c) Internalisation of BEVs VC1620/1:: tetR by V. cholerae WT. Rhodamine‐labelled BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co) were incubated with V. cholerae WT for 20 h. In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). (d) Internalisation of BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) by V. cholerae WT or the deletion mutants ∆ pilA and ∆ comEA . (c, d) Uptake is detected by an increase in relative fluorescence units (RFU) measured every 30 min. Wells containing rhodamine‐labelled BEVs VC1620/1:: tetR without recipient cells served as a blank. Shown is the median ± IQR ( n = 13). The bar chart on the right shows the median area under the curve (AUC) ± IQR calculated from the internalisation assays. Asterisks highlight significant differences between respective data sets (* p < 0.05 Kruskal–Wallis test followed by post hoc Dunn's multiple comparisons). (e) Colonisation fitness of VC1620/1:: tetR and ∆ comEA . Results are shown as competitive index (CI) for competitions of VC1620/1:: tetR or ∆ comEA to a fully virulent LacZ − derivative of the WT ( lacZ − ) in LB (in vitro) and in adult mice (in vivo). Each circle represents the CI from a single assay. Horizontal bars and error bars indicate the median ± IQR. Asterisks highlight data sets with significantly different CI from the theoretical value of 1 [ p < 0.05, Wilcoxon test against a hypothetical value of 1, n = 14 for VC1620/21:: tetR /WT ( lacZ − ) in vitro; n = 12 for ∆ comEA /WT ( lacZ − ) in vitro; n = 8 for VC1620/21:: tetR /WT ( lacZ − ) in vivo; and n = 6 for ∆ comEA /WT ( lacZ − ) in vivo]. (f) In vivo HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or ∆ comEA as recipient. Mice colonised with WT or ∆ comEA received BEVs VC1620/1:: tetR VC1620/1:: tetR by oral gavage twice a day for two days before mice were euthanised and total CFU and transformants were determined by plating the homogenised colon on LB‐Sm and LB‐Tet plates. (a, b, f) Data are presented as median ± IQR. Assays yielding in no transformants on LB‐Tet were set to limit of detection (LOD), which is indicated by a dotted line. The LOD was defined as 0.5 CFU detected in the highest concentration plated on LB‐Tet plates divided by the total CFU determined by plating on LB‐Sm plates. HGT rates significantly higher than the LOD were by evaluated by the Wilcoxon Signed Rank test against the hypothetical value of the LOD (* p < 0.05, n = 8 for Panels a and b, n = 10 for Panel f). Statistically significant differences between the bile‐induced BEVs VC1620/1:: tetR before and after trypsin digest ( n = 8) or between the WT and ∆ comEA colonised mice ( n = 10) were analysed via the Mann–Whitney U test (* p < 0.05). BEV, bacterial extracellular vesicle; IQR, interquartile range; MMC, mitomycin C.
    Base Cutter Psti, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/psti/PstI/pmc13108426-137-5-13
    Average 97 stars, based on 1 article reviews
    base cutter psti - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    New England Biolabs psti hf
    Stress‐induced BEVs are internalised by recipient cells and mediate horizontal gene transfer (HGT). (a) HGT rate of the tetR ‐cassette using BEVs derived from VC1620/1:: tetR (BEVs VC1620/1:: tetR ) as donor. BEVs VC1620/1:: tetR were isolated from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co). In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). The purified linearised plasmid <t>pBR322</t> (lin PstI) served as an extracellular DNA control. V. cholerae WT grown in AKI or SOC: HEPES served as recipient and was incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) or pBR322 linearised with PstI (100 ng) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (b) HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or diverse V. cholerae mutants as recipient. Recipients, grown in AKI or SOC: HEPES, were incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (c) Internalisation of BEVs VC1620/1:: tetR by V. cholerae WT. Rhodamine‐labelled BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co) were incubated with V. cholerae WT for 20 h. In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). (d) Internalisation of BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) by V. cholerae WT or the deletion mutants ∆ pilA and ∆ comEA . (c, d) Uptake is detected by an increase in relative fluorescence units (RFU) measured every 30 min. Wells containing rhodamine‐labelled BEVs VC1620/1:: tetR without recipient cells served as a blank. Shown is the median ± IQR ( n = 13). The bar chart on the right shows the median area under the curve (AUC) ± IQR calculated from the internalisation assays. Asterisks highlight significant differences between respective data sets (* p < 0.05 Kruskal–Wallis test followed by post hoc Dunn's multiple comparisons). (e) Colonisation fitness of VC1620/1:: tetR and ∆ comEA . Results are shown as competitive index (CI) for competitions of VC1620/1:: tetR or ∆ comEA to a fully virulent LacZ − derivative of the WT ( lacZ − ) in LB (in vitro) and in adult mice (in vivo). Each circle represents the CI from a single assay. Horizontal bars and error bars indicate the median ± IQR. Asterisks highlight data sets with significantly different CI from the theoretical value of 1 [ p < 0.05, Wilcoxon test against a hypothetical value of 1, n = 14 for VC1620/21:: tetR /WT ( lacZ − ) in vitro; n = 12 for ∆ comEA /WT ( lacZ − ) in vitro; n = 8 for VC1620/21:: tetR /WT ( lacZ − ) in vivo; and n = 6 for ∆ comEA /WT ( lacZ − ) in vivo]. (f) In vivo HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or ∆ comEA as recipient. Mice colonised with WT or ∆ comEA received BEVs VC1620/1:: tetR VC1620/1:: tetR by oral gavage twice a day for two days before mice were euthanised and total CFU and transformants were determined by plating the homogenised colon on LB‐Sm and LB‐Tet plates. (a, b, f) Data are presented as median ± IQR. Assays yielding in no transformants on LB‐Tet were set to limit of detection (LOD), which is indicated by a dotted line. The LOD was defined as 0.5 CFU detected in the highest concentration plated on LB‐Tet plates divided by the total CFU determined by plating on LB‐Sm plates. HGT rates significantly higher than the LOD were by evaluated by the Wilcoxon Signed Rank test against the hypothetical value of the LOD (* p < 0.05, n = 8 for Panels a and b, n = 10 for Panel f). Statistically significant differences between the bile‐induced BEVs VC1620/1:: tetR before and after trypsin digest ( n = 8) or between the WT and ∆ comEA colonised mice ( n = 10) were analysed via the Mann–Whitney U test (* p < 0.05). BEV, bacterial extracellular vesicle; IQR, interquartile range; MMC, mitomycin C.
    Psti Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/psti/PstI-HF/bio_rxiv__64898__2026__04__21__719910-129-20-22
    Average 97 stars, based on 1 article reviews
    psti hf - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    Image Search Results


    Stress‐induced BEVs are internalised by recipient cells and mediate horizontal gene transfer (HGT). (a) HGT rate of the tetR ‐cassette using BEVs derived from VC1620/1:: tetR (BEVs VC1620/1:: tetR ) as donor. BEVs VC1620/1:: tetR were isolated from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co). In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). The purified linearised plasmid pBR322 (lin PstI) served as an extracellular DNA control. V. cholerae WT grown in AKI or SOC: HEPES served as recipient and was incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) or pBR322 linearised with PstI (100 ng) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (b) HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or diverse V. cholerae mutants as recipient. Recipients, grown in AKI or SOC: HEPES, were incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (c) Internalisation of BEVs VC1620/1:: tetR by V. cholerae WT. Rhodamine‐labelled BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co) were incubated with V. cholerae WT for 20 h. In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). (d) Internalisation of BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) by V. cholerae WT or the deletion mutants ∆ pilA and ∆ comEA . (c, d) Uptake is detected by an increase in relative fluorescence units (RFU) measured every 30 min. Wells containing rhodamine‐labelled BEVs VC1620/1:: tetR without recipient cells served as a blank. Shown is the median ± IQR ( n = 13). The bar chart on the right shows the median area under the curve (AUC) ± IQR calculated from the internalisation assays. Asterisks highlight significant differences between respective data sets (* p < 0.05 Kruskal–Wallis test followed by post hoc Dunn's multiple comparisons). (e) Colonisation fitness of VC1620/1:: tetR and ∆ comEA . Results are shown as competitive index (CI) for competitions of VC1620/1:: tetR or ∆ comEA to a fully virulent LacZ − derivative of the WT ( lacZ − ) in LB (in vitro) and in adult mice (in vivo). Each circle represents the CI from a single assay. Horizontal bars and error bars indicate the median ± IQR. Asterisks highlight data sets with significantly different CI from the theoretical value of 1 [ p < 0.05, Wilcoxon test against a hypothetical value of 1, n = 14 for VC1620/21:: tetR /WT ( lacZ − ) in vitro; n = 12 for ∆ comEA /WT ( lacZ − ) in vitro; n = 8 for VC1620/21:: tetR /WT ( lacZ − ) in vivo; and n = 6 for ∆ comEA /WT ( lacZ − ) in vivo]. (f) In vivo HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or ∆ comEA as recipient. Mice colonised with WT or ∆ comEA received BEVs VC1620/1:: tetR VC1620/1:: tetR by oral gavage twice a day for two days before mice were euthanised and total CFU and transformants were determined by plating the homogenised colon on LB‐Sm and LB‐Tet plates. (a, b, f) Data are presented as median ± IQR. Assays yielding in no transformants on LB‐Tet were set to limit of detection (LOD), which is indicated by a dotted line. The LOD was defined as 0.5 CFU detected in the highest concentration plated on LB‐Tet plates divided by the total CFU determined by plating on LB‐Sm plates. HGT rates significantly higher than the LOD were by evaluated by the Wilcoxon Signed Rank test against the hypothetical value of the LOD (* p < 0.05, n = 8 for Panels a and b, n = 10 for Panel f). Statistically significant differences between the bile‐induced BEVs VC1620/1:: tetR before and after trypsin digest ( n = 8) or between the WT and ∆ comEA colonised mice ( n = 10) were analysed via the Mann–Whitney U test (* p < 0.05). BEV, bacterial extracellular vesicle; IQR, interquartile range; MMC, mitomycin C.

    Journal: Journal of Extracellular Vesicles

    Article Title: Host Factor Induced Bacterial Extracellular Vesicles Promote Horizontal Gene Transfer in Vibrio cholerae

    doi: 10.1002/jev2.70301

    Figure Lengend Snippet: Stress‐induced BEVs are internalised by recipient cells and mediate horizontal gene transfer (HGT). (a) HGT rate of the tetR ‐cassette using BEVs derived from VC1620/1:: tetR (BEVs VC1620/1:: tetR ) as donor. BEVs VC1620/1:: tetR were isolated from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co). In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). The purified linearised plasmid pBR322 (lin PstI) served as an extracellular DNA control. V. cholerae WT grown in AKI or SOC: HEPES served as recipient and was incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) or pBR322 linearised with PstI (100 ng) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (b) HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or diverse V. cholerae mutants as recipient. Recipients, grown in AKI or SOC: HEPES, were incubated for 20 h at 30°C and 150 rpm with respective BEVs VC1620/1:: tetR (2.5 × 10 11 particles) before total CFU and transformants were determined by plating on LB‐Sm and LB‐Tet plates. (c) Internalisation of BEVs VC1620/1:: tetR by V. cholerae WT. Rhodamine‐labelled BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) or MMC (60 ng mL −1 ) or without any stressor (control, co) were incubated with V. cholerae WT for 20 h. In addition, trypsin digested BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) were used (see methods for detail). (d) Internalisation of BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) by V. cholerae WT or the deletion mutants ∆ pilA and ∆ comEA . (c, d) Uptake is detected by an increase in relative fluorescence units (RFU) measured every 30 min. Wells containing rhodamine‐labelled BEVs VC1620/1:: tetR without recipient cells served as a blank. Shown is the median ± IQR ( n = 13). The bar chart on the right shows the median area under the curve (AUC) ± IQR calculated from the internalisation assays. Asterisks highlight significant differences between respective data sets (* p < 0.05 Kruskal–Wallis test followed by post hoc Dunn's multiple comparisons). (e) Colonisation fitness of VC1620/1:: tetR and ∆ comEA . Results are shown as competitive index (CI) for competitions of VC1620/1:: tetR or ∆ comEA to a fully virulent LacZ − derivative of the WT ( lacZ − ) in LB (in vitro) and in adult mice (in vivo). Each circle represents the CI from a single assay. Horizontal bars and error bars indicate the median ± IQR. Asterisks highlight data sets with significantly different CI from the theoretical value of 1 [ p < 0.05, Wilcoxon test against a hypothetical value of 1, n = 14 for VC1620/21:: tetR /WT ( lacZ − ) in vitro; n = 12 for ∆ comEA /WT ( lacZ − ) in vitro; n = 8 for VC1620/21:: tetR /WT ( lacZ − ) in vivo; and n = 6 for ∆ comEA /WT ( lacZ − ) in vivo]. (f) In vivo HGT rate of the tetR ‐cassette using BEVs VC1620/1:: tetR derived from AKI cultures in presence of bile (17.25 mM) as donor and V. cholerae WT or ∆ comEA as recipient. Mice colonised with WT or ∆ comEA received BEVs VC1620/1:: tetR VC1620/1:: tetR by oral gavage twice a day for two days before mice were euthanised and total CFU and transformants were determined by plating the homogenised colon on LB‐Sm and LB‐Tet plates. (a, b, f) Data are presented as median ± IQR. Assays yielding in no transformants on LB‐Tet were set to limit of detection (LOD), which is indicated by a dotted line. The LOD was defined as 0.5 CFU detected in the highest concentration plated on LB‐Tet plates divided by the total CFU determined by plating on LB‐Sm plates. HGT rates significantly higher than the LOD were by evaluated by the Wilcoxon Signed Rank test against the hypothetical value of the LOD (* p < 0.05, n = 8 for Panels a and b, n = 10 for Panel f). Statistically significant differences between the bile‐induced BEVs VC1620/1:: tetR before and after trypsin digest ( n = 8) or between the WT and ∆ comEA colonised mice ( n = 10) were analysed via the Mann–Whitney U test (* p < 0.05). BEV, bacterial extracellular vesicle; IQR, interquartile range; MMC, mitomycin C.

    Article Snippet: Linearised pBR322 serving as control for HGT assays was generated by digestion of purified pBR322 with PstI (20 U μL −1 , NEB) according to the manufacturer protocol and subsequently heat inactivated at 80°C for 25 min. A proportion of the digestion reaction was analysed by agarose gel electrophoresis alongside undigested purified plasmid as control to conform complete linearisation.

    Techniques: Derivative Assay, Isolation, Control, Purification, Plasmid Preparation, Incubation, Fluorescence, In Vitro, In Vivo, Concentration Assay, MANN-WHITNEY